Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG13400.1 | CBG13400.1 | [unknown] |
Other
10 Allele
| Public Name |
|---|
| WBVar00119727 |
| WBVar00119725 |
| WBVar00119726 |
| WBVar00119718 |
| WBVar00119719 |
| WBVar00119723 |
| WBVar00119724 |
| WBVar00119721 |
| WBVar00119722 |
| WBVar00119720 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_downregulated | |
| C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo. | Benjamin and Hochberg corrected p-value < 0.05. | WBPaper00051425:CB_L4_vs_embryo_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-puf-12, TGCTCCAAGTCGGCGGGCCAAAAGTGGTTGAGAAGCTGAAGGCGTCGATCAGCAGAAAAC, WBGene00034174 | Expr1055493 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
