Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG12913.1 | CBG12913.1 | [unknown] |
Other
13 Allele
| Public Name |
|---|
| WBVar00119118 |
| WBVar00119119 |
| WBVar00119116 |
| WBVar00119117 |
| WBVar00119114 |
| WBVar00119115 |
| WBVar00119113 |
| WBVar00119121 |
| WBVar00119122 |
| WBVar00119120 |
| WBVar00119125 |
| WBVar00119123 |
| WBVar00119124 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG12913, AATTGCAATTCGCTAGAGAATACGCGAACGCCGAAGCCGAACTTTTCGAGAAGACTGTTC, WBGene00033779 | Expr1069843 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
