WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00033266 Gene Name  Cbr-sup-26
Sequence Name  ? CBG12298 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable RNA binding activity. Is an ortholog of C. elegans sup-26. In C. elegans, sup-26 is involved in negative regulation of translation. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

9 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG12298b.1 CBG12298b.1   [unknown]
Transcript:CBG12298c.1 CBG12298c.1   [unknown]
Transcript:CBG12298a.1 CBG12298a.1   [unknown]
Transcript:CBG12298g.1 CBG12298g.1   [unknown]
Transcript:CBG12298d.2 CBG12298d.2   [unknown]
Transcript:CBG12298d.1 CBG12298d.1   [unknown]
Transcript:CBG12298e.1 CBG12298e.1   [unknown]
Transcript:CBG12298f.1 CBG12298f.1   [unknown]
Transcript:CBG12298f.2 CBG12298f.2   [unknown]
 

Other

7 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG12298b CBG12298b   [unknown]
CDS:CBG12298c CBG12298c   [unknown]
CDS:CBG12298a CBG12298a   [unknown]
CDS:CBG12298f CBG12298f   [unknown]
CDS:CBG12298g CBG12298g   [unknown]
CDS:CBG12298d CBG12298d   [unknown]
CDS:CBG12298e CBG12298e   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_upregulated
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day1_upregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-tag-310, ATCCAACGTATGCAATATCCACAAGTCTATCAATCGTACTATGGCTACCCACCAGCCATT, WBGene00033266   Expr1060498 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  enables

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region