WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00033216 Gene Name  Cbr-lin-11
Sequence Name  ? CBG12236 Brief Description  Cbr-lin-11 encodes a LIM Homeodomain containing protein that is orthologous to C. elegans lin-11; Cbr-lin-11 is involved in multiple processes including vulval morphogenesis, vulva-uterine connection formation, and thermosensation; Cbr-lin-11::GFP expression is detected in developing vulval cells, uterine pi lineage cells and several neurons; while the vulval expression is mediated by Wnt signaling, the LIN-12/Notch pathway controls uterine expression of Cbr-lin-11.
Organism  Caenorhabditis briggsae Automated Description  Predicted to enable DNA binding activity. Is an ortholog of C. elegans lin-11. In C. elegans, lin-11 is involved in several processes, including axonal fasciculation; egg-laying behavior; and positive regulation of vulval development.
Biotype  SO:0001217 Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG12236.1 CBG12236.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG12236 CBG12236   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_upregulated
  Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day6_vs_Day1_downregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-lin-11, ATCGTCAACACCACCAGAGTTCAATGAAGATGCATTCACATGCATTTATTCCACTGATGT, WBGene00033216   Expr1059163 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region