Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG12231.1 | CBG12231.1 | [unknown] |
Other
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| C.briggsae proteins that showed significantly increased at L1 larva stage than in emrbyo. | Benjamin and Hochberg corrected p-value < 0.05. | WBPaper00051425:CB_L1_vs_embryo_upregulated |
2 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG12230, GTCAAGTCTGATGTCTCTGACGCGGTTCACCGCCACGCACAAATGCACATATATTCTTGC, WBGene00033211 | Expr1069305 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
| CBG12231, TCGAAACCTTGTCGTGAAAATGGATCGCTTCGAGAAGGAGCCAGAACACAAAGAAGGTGG, WBGene00033212 | Expr1057667 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
