Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG11879.1 | CBG11879.1 | [unknown] |
Other
50 Allele
| Public Name |
|---|
| WBVar00117988 |
| WBVar00117987 |
| WBVar00117989 |
| WBVar00117995 |
| WBVar00117994 |
| WBVar00117997 |
| WBVar00117996 |
| WBVar00117991 |
| WBVar00117990 |
| WBVar00117993 |
| WBVar00117992 |
| WBVar00117977 |
| WBVar00117979 |
| WBVar00117978 |
| WBVar00117984 |
| WBVar00117983 |
| WBVar00117986 |
| WBVar00117985 |
| WBVar00117980 |
| WBVar00117982 |
| WBVar00117981 |
| WBVar00117999 |
| WBVar00117998 |
| WBVar00118000 |
| WBVar00118006 |
| WBVar00118005 |
| WBVar00118008 |
| WBVar00118007 |
| WBVar00118002 |
| WBVar00118001 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-lars-2, CTGATGATTGACGGCGTCAGTGGAGGACGTCCAAGTGTTGGAAGACAGAAAATTGAAAAT, WBGene00032918 | Expr1056092 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
7 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| involved_in |
