Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG11743.1 | CBG11743.1 | [unknown] |
Other
20 Allele
| Public Name |
|---|
| WBVar00117548 |
| WBVar00117547 |
| WBVar00117549 |
| WBVar00117555 |
| WBVar00117554 |
| WBVar00117557 |
| WBVar00117556 |
| WBVar00117551 |
| WBVar00117550 |
| WBVar00117553 |
| WBVar00117552 |
| WBVar00117539 |
| WBVar00117544 |
| WBVar00117543 |
| WBVar00117546 |
| WBVar00117545 |
| WBVar00117540 |
| WBVar00117542 |
| WBVar00117541 |
| WBVar00117558 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_downregulated | |
| Transcripts that showed significantly increased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-polh-1, GATTGGTGAAAGAGCTGGCGAAACGATTGGGGACGGATCAGGCTGAAAACAAGAGAACTG, WBGene00032820 | Expr1066756 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
