Genomics
3 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG11408a.1 | CBG11408a.1 | [unknown] | |
| Transcript:CBG11408b.2 | CBG11408b.2 | [unknown] | |
| Transcript:CBG11408b.1 | CBG11408b.1 | [unknown] |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:CBG11408a | CBG11408a | [unknown] | |
| CDS:CBG11408b | CBG11408b | [unknown] |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_downregulated | |
| C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo. | Benjamin and Hochberg corrected p-value < 0.05. | WBPaper00051425:CB_L4_vs_embryo_upregulated | |
| C.briggsae proteins that showed significantly increased at L1 larva stage than in emrbyo. | Benjamin and Hochberg corrected p-value < 0.05. | WBPaper00051425:CB_L1_vs_embryo_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG11408, TTCACCCATACCAACGCCTCAAAGGCAAAAGACCTTTTGAAGGTTCTCGACGAAGCCAAG, WBGene00032524 | Expr1070183 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
