Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG10365.1 | CBG10365.1 | [unknown] |
Other
28 Allele
| Public Name |
|---|
| WBVar00037989 |
| WBVar00037984 |
| WBVar00037994 |
| WBVar00037999 |
| WBVar00037959 |
| WBVar00037954 |
| WBVar00037969 |
| WBVar00037964 |
| WBVar00037979 |
| WBVar00037974 |
| WBVar00115730 |
| WBVar00115731 |
| WBVar00115743 |
| WBVar00115744 |
| WBVar00115745 |
| WBVar00115736 |
| WBVar00115737 |
| WBVar00115738 |
| WBVar00115739 |
| WBVar00115732 |
| WBVar00115733 |
| WBVar00115734 |
| WBVar00115735 |
| WBVar00115740 |
| WBVar00115741 |
| WBVar00115742 |
| WBVar00010029 |
| WBVar00010024 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-nhr-181, GTCAAAGCAATCTACAATCATACACGCGTCTCGGACATCTTCCATCTGATGACGTTCGAT, WBGene00031766 | Expr1062593 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
