WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00031583 Gene Name  CBG10108
Sequence Name  ? CBG10108 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable chitin binding activity. Predicted to be located in extracellular region. Is an ortholog of C. elegans chtb-1. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

10 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG10108h.1 CBG10108h.1   [unknown]
Transcript:CBG10108h.2 CBG10108h.2   [unknown]
Transcript:CBG10108g.2 CBG10108g.2   [unknown]
Transcript:CBG10108g.1 CBG10108g.1   [unknown]
Transcript:CBG10108f.1 CBG10108f.1   [unknown]
Transcript:CBG10108e.1 CBG10108e.1   [unknown]
Transcript:CBG10108d.1 CBG10108d.1   [unknown]
Transcript:CBG10108c.1 CBG10108c.1   [unknown]
Transcript:CBG10108b.1 CBG10108b.1   [unknown]
Transcript:CBG10108a.1 CBG10108a.1   [unknown]
 

Other

8 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG10108a CBG10108a   [unknown]
CDS:CBG10108g CBG10108g   [unknown]
CDS:CBG10108f CBG10108f   [unknown]
CDS:CBG10108h CBG10108h   [unknown]
CDS:CBG10108c CBG10108c   [unknown]
CDS:CBG10108b CBG10108b   [unknown]
CDS:CBG10108e CBG10108e   [unknown]
CDS:CBG10108d CBG10108d   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_upregulated
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day1_upregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG10108, GAACCGGTTTCGAGTGCGTCTCATCATTGAATCTCTGTTGTCCACCAGGTCAACCACAAA, WBGene00031583   Expr1057890 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  located_in

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  located_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region