Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG10060a.1 | CBG10060a.1 | [unknown] | |
| Transcript:CBG10060b.1 | CBG10060b.1 | [unknown] |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:CBG10060a | CBG10060a | [unknown] | |
| CDS:CBG10060b | CBG10060b | [unknown] |
9 Allele
| Public Name |
|---|
| WBVar00115527 |
| WBVar00115528 |
| WBVar00115529 |
| WBVar00115530 |
| WBVar00115531 |
| WBVar00115532 |
| WBVar00115533 |
| WBVar00115534 |
| WBVar00115535 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_downregulated | |
| Transcripts that showed significantly increased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG10060, TACCAGAAATCCGTTGGAACATCTAGGAAACTTTTTGAACTTTTTCAATTTGGATATTCG, WBGene00031541 | Expr1064400 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
