WormBase Gene ID
|
WBGene00031517 | Gene Name | CBG10032 |
| Sequence Name
|
CBG10032 | Organism | Caenorhabditis briggsae |
| Automated Description | Predicted to enable DNA binding activity and protein heterodimerization activity. Predicted to be a structural constituent of chromatin. Predicted to be part of nucleosome. Is an ortholog of C. elegans cpar-1 and hcp-3. In C. elegans, hcp-3 is involved in several processes, including membraneless organelle assembly; negative regulation of mitotic centrosome separation; and protein localization to chromosome. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG10032.1 | CBG10032.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-cpar-1, GTACTGATTTGCAATCACGCTAAGCGTGTCACACTCATGCCCACTGACATTCAGCTGTAT, WBGene00031517 | Expr1062756 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
