WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00031495 Gene Name  Cbr-cdk-1
Sequence Name  ? CBG10007 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable ATP binding activity and protein kinase activity. Predicted to be involved in protein phosphorylation. Is an ortholog of C. elegans cdk-1. In C. elegans, cdk-1 is involved in several processes, including positive regulation of meiotic nuclear division; positive regulation of proteasomal ubiquitin-dependent protein catabolic process; and sexual reproduction. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG10007.1 CBG10007.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG10007 CBG10007   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

3 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly decreased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_downregulated
  C.briggsae proteins that showed significantly decreased at L1 larva stage than in emrbyo. Benjamin and Hochberg corrected p-value < 0.05. WBPaper00051425:CB_L1_vs_embryo_downregulated
  C.briggsae proteins that showed significantly decreased at L4 larva stage than in emrbyo. Benjamin and Hochberg corrected p-value < 0.05. WBPaper00051425:CB_L4_vs_embryo_downregulated

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-cdk-1, GGATGCATCTTCGCTGAAATGGCTACCAAAAAGCCTCTCTTCCAAGGAGATTCGGAGATC, WBGene00031495   Expr1061063 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG10006, TGGATCGAGCAGATCTTTATGAGAAGAACGAAGCTGTCGCCCAACAAAGAAGAGATGTCG, WBGene00031494   Expr1056970 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

3 GO Annotation

Annotation Extension Qualifier
  enables
  enables
  involved_in

0 Homologues

0 Locations

3 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region