Genomics
3 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG09855c.1 | CBG09855c.1 | [unknown] | |
| Transcript:CBG09855b.1 | CBG09855b.1 | [unknown] | |
| Transcript:CBG09855a.1 | CBG09855a.1 | [unknown] |
Other
3 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:CBG09855a | CBG09855a | [unknown] | |
| CDS:CBG09855b | CBG09855b | [unknown] | |
| CDS:CBG09855c | CBG09855c | [unknown] |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated | |
| Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated |
2 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG25883, GGAAAATTACCAATCAAACCATCACAAGATCCAACACTTCCCGAGACGGATCTGCGTTCG, WBGene00087297 | Expr1062667 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
| Cbr-gei-1, GAGCGAAGTGTGAAGTGCTCGGAAGACCAGTTGTTGGGTGGAATCGCGGCTACAATATTT, WBGene00031371 | Expr1056410 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
