WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00030995 Gene Name  Cbr-uig-1
Sequence Name  ? CBG09405 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable guanyl-nucleotide exchange factor activity. Is an ortholog of C. elegans uig-1. In C. elegans, uig-1 is involved in regulation of engulfment of apoptotic cell. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

11 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG09405i.1 CBG09405i.1   [unknown]
Transcript:CBG09405h.1 CBG09405h.1   [unknown]
Transcript:CBG09405e.1 CBG09405e.1   [unknown]
Transcript:CBG09405d.1 CBG09405d.1   [unknown]
Transcript:CBG09405g.1 CBG09405g.1   [unknown]
Transcript:CBG09405f.1 CBG09405f.1   [unknown]
Transcript:CBG09405a.2 CBG09405a.2   [unknown]
Transcript:CBG09405a.1 CBG09405a.1   [unknown]
Transcript:CBG09405a.3 CBG09405a.3   [unknown]
Transcript:CBG09405c.1 CBG09405c.1   [unknown]
Transcript:CBG09405b.1 CBG09405b.1   [unknown]
 

Other

9 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG09405h CBG09405h   [unknown]
CDS:CBG09405i CBG09405i   [unknown]
CDS:CBG09405a CBG09405a   [unknown]
CDS:CBG09405b CBG09405b   [unknown]
CDS:CBG09405c CBG09405c   [unknown]
CDS:CBG09405d CBG09405d   [unknown]
CDS:CBG09405e CBG09405e   [unknown]
CDS:CBG09405f CBG09405f   [unknown]
CDS:CBG09405g CBG09405g   [unknown]

0 RNAi Result

2 Allele

Public Name
WBVar00031804
WBVar00004354

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_upregulated
  Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day6_vs_Day1_downregulated

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-uig-1, ATGCTAAACGAATGGATTTGTCCAGAAGAACCATTGAGCTTCCAAGTGTTGTCTTTTGAC, WBGene00030995   Expr1051916 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG09403, GGATCCGCAGGAGGTTCAGCTACTACGAGGATAAACATCAGTTCCAGGAATGTGCAAATG, WBGene00030994   Expr1056825 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region