WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00030954 Gene Name  Cbr-memb-2
Sequence Name  ? CBG09355 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable SNAP receptor activity. Predicted to be involved in vesicle-mediated transport. Predicted to be located in Golgi apparatus. Is an ortholog of C. elegans memb-2. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG09355.1 CBG09355.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG09355 CBG09355   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

3 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-htz-1(gu167)_upregulated
  Transcripts that showed significantly decreased expression in nos-1(gv5)nos-2(RNAi) comparing to in wild type, in primordial germ cells (PGCs) at L1 larva, according to SMARTseq. For differential gene expression analysis, sets of independent mutant and control mapped reads (e.g biological replicates) were used in cuffdiff analysis. The cutoff of FDR(q value)=0.05 was used as a significance cutoff for all the analyses. WBPaper00053321:nos-1(gv5)nos-2(RNAi)_downregulated_L1_SMARTseq
  Transcripts that showed significantly increased expression in L1 larva comparing to in embryo, in primordial germ cells (PGCs) of N2 animals fed with control bacteria, according to SMARTseq. For differential gene expression analysis, sets of independent mutant and control mapped reads (e.g biological replicates) were used in cuffdiff analysis. The cutoff of FDR(q value)=0.05 was used as a significance cutoff for all the analyses. WBPaper00053321:embryo-to-L1_upregulated_WT_SMARTseq

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-memb-2, AACGCGTGCGAGAAGACAAGAAGCTATTCTACATCGGTGTAACTTGTTGCTTGATTTTCA, WBGene00030954   Expr1051340 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

3 GO Annotation

Annotation Extension Qualifier
  enables
  involved_in
  located_in

0 Homologues

0 Locations

3 Ontology Annotations

Annotation Extension Qualifier
  enables
  involved_in
  located_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region