Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG09015.1 | CBG09015.1 | [unknown] |
Other
25 Allele
| Public Name |
|---|
| WBVar00114269 |
| WBVar00114271 |
| WBVar00114270 |
| WBVar00114273 |
| WBVar00114272 |
| WBVar00114259 |
| WBVar00114258 |
| WBVar00114260 |
| WBVar00114264 |
| WBVar00114263 |
| WBVar00114262 |
| WBVar00114261 |
| WBVar00114268 |
| WBVar00114267 |
| WBVar00114266 |
| WBVar00114265 |
| WBVar00114249 |
| WBVar00114253 |
| WBVar00114252 |
| WBVar00114251 |
| WBVar00114250 |
| WBVar00114257 |
| WBVar00114256 |
| WBVar00114255 |
| WBVar00114254 |
4 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_downregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_downregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-kin-5, AGGAAATCATGCATGAAGCGAGATTGATGAGAAAATTCAAACATCCGAACGTCGTCACTT, WBGene00030686 | Expr1067621 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
