Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG08960.1 | CBG08960.1 | [unknown] |
Other
13 Allele
| Public Name |
|---|
| WBVar00137011 |
| WBVar00114202 |
| WBVar00114201 |
| WBVar00114200 |
| WBVar00114206 |
| WBVar00114205 |
| WBVar00114204 |
| WBVar00114203 |
| WBVar00114209 |
| WBVar00114208 |
| WBVar00114207 |
| WBVar00114198 |
| WBVar00114199 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-ckk-1, CTGTGAAAGATCCAACCTATGTTCCACCTCCAAATTCTCCTCCAGCAACATCTAACAACA, WBGene00030644 | Expr1060778 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
