Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG08841.1 | CBG08841.1 | [unknown] |
Other
40 Allele
| Public Name |
|---|
| WBVar00136989 |
| WBVar00136990 |
| WBVar00136992 |
| WBVar00136991 |
| WBVar00136994 |
| WBVar00136993 |
| WBVar00136996 |
| WBVar00136995 |
| WBVar00136998 |
| WBVar00136997 |
| WBVar00136999 |
| WBVar00114125 |
| WBVar00114124 |
| WBVar00114129 |
| WBVar00114128 |
| WBVar00114127 |
| WBVar00114126 |
| WBVar00114132 |
| WBVar00114131 |
| WBVar00114130 |
| WBVar00114136 |
| WBVar00114135 |
| WBVar00114134 |
| WBVar00114133 |
| WBVar00010307 |
| WBVar00010302 |
| WBVar00010347 |
| WBVar00010342 |
| WBVar00010337 |
| WBVar00010332 |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_downregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG08841, CATGGACACCCAACTGACGCCTACAGGTCGTATGTATGGATCAAGGCTAATGAGAACATT, WBGene00030562 | Expr1062934 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
