Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG08751.1 | CBG08751.1 | [unknown] |
Other
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated |
2 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Expr4691 | GFP was detected in epidermal cells including the head epidermal cells hyp1 to hyp5, the hyp7 syncytium, the tail epidermal cells hyp8 to hyp11, and the ventral Pn.p cells. GFP expression was also detected in the excretory duct cell. | |||
| Cbr-catp-1, ATCGTCGGTCTCTATTTGTTGGCTTTCAACGAGATGCGTAAATATTTTATTCGAAACTTC, WBGene00030489 | Expr1051003 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
