Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG07033.1 | CBG07033.1 | [unknown] |
Other
15 Allele
| Public Name |
|---|
| WBVar00042919 |
| WBVar00042929 |
| WBVar00042924 |
| WBVar00111971 |
| WBVar00111976 |
| WBVar00111977 |
| WBVar00111974 |
| WBVar00111975 |
| WBVar00014524 |
| WBVar00014529 |
| WBVar00014534 |
| WBVar00014539 |
| WBVar00014509 |
| WBVar00014514 |
| WBVar00014519 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG07033, TTCAAATCTTATGGAAACGGTTGAAAGGGAAATCTCATGGTTATCCGGGTTTCCGAAGGT, WBGene00029208 | Expr1064157 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
