Genomics
5 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG06966d.1 | CBG06966d.1 | [unknown] | |
| Transcript:CBG06966c.1 | CBG06966c.1 | [unknown] | |
| Transcript:CBG06966b.1 | CBG06966b.1 | [unknown] | |
| Transcript:CBG06966a.1 | CBG06966a.1 | [unknown] | |
| Transcript:CBG06966a.2 | CBG06966a.2 | [unknown] |
Other
4 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:CBG06966c | CBG06966c | [unknown] | |
| CDS:CBG06966d | CBG06966d | [unknown] | |
| CDS:CBG06966a | CBG06966a | [unknown] | |
| CDS:CBG06966b | CBG06966b | [unknown] |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
2 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG06967, TGGTAGAAGAATGGGTTCAAGATTCACAAAATGGATCTCAAGTCCCGCTGGATCACTTAG, WBGene00029147 | Expr1061631 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
| Cbr-chs-2, GTCAAGTGATGTATCTTTACTACCTGCTCGGATATAGACTAATGATGAAAGTGGATGATC, WBGene00029146 | Expr1056030 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
