Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG06809.1 | CBG06809.1 | [unknown] |
Other
4 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_upregulated | |
| Transcripts that showed significantly increased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_upregulated | |
| Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-htz-1(gu167)_upregulated | |
| Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated |
2 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Expr10979 | Cb-glp-1 mRNA is present throughout both the germline and embryo, but Cb-GLP-1 protein is present only in the mitotic region of the germline and only in the anterior blastomeres of the embryo. | |||
| Cbr-glp-1, GAAGACTCCTATGATTCAAGAAACGAACCATTTGACGCCTCCACACTCGGATGGATCGTT, WBGene00029022 | Expr1065366 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
5 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in |
