Genomics
6 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG06769f.1 | CBG06769f.1 | [unknown] | |
| Transcript:CBG06769e.1 | CBG06769e.1 | [unknown] | |
| Transcript:CBG06769d.1 | CBG06769d.1 | [unknown] | |
| Transcript:CBG06769c.1 | CBG06769c.1 | [unknown] | |
| Transcript:CBG06769b.1 | CBG06769b.1 | [unknown] | |
| Transcript:CBG06769a.1 | CBG06769a.1 | [unknown] |
Other
6 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:CBG06769c | CBG06769c | [unknown] | |
| CDS:CBG06769b | CBG06769b | [unknown] | |
| CDS:CBG06769a | CBG06769a | [unknown] | |
| CDS:CBG06769f | CBG06769f | [unknown] | |
| CDS:CBG06769e | CBG06769e | [unknown] | |
| CDS:CBG06769d | CBG06769d | [unknown] |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-ncx-2, GTATTGCAGTTTTGGTGTTGAGAAGAAGCAAGAAGGTTGGAGGAGAGTTGGGAGGACCAA, WBGene00028992 | Expr1058874 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
5 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| located_in |
