WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00028233 Gene Name  Cbr-unc-82
Sequence Name  ? CBG05865 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable ATP binding activity and protein kinase activity. Predicted to be involved in protein phosphorylation. Is an ortholog of C. elegans unc-82. In C. elegans, unc-82 is involved in striated muscle myosin thick filament assembly and striated muscle paramyosin thick filament assembly. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

6 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG05865a.1 CBG05865a.1   [unknown]
Transcript:CBG05865b.1 CBG05865b.1   [unknown]
Transcript:CBG05865e.1 CBG05865e.1   [unknown]
Transcript:CBG05865f.1 CBG05865f.1   [unknown]
Transcript:CBG05865c.1 CBG05865c.1   [unknown]
Transcript:CBG05865d.1 CBG05865d.1   [unknown]
 

Other

6 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG05865d CBG05865d   [unknown]
CDS:CBG05865e CBG05865e   [unknown]
CDS:CBG05865b CBG05865b   [unknown]
CDS:CBG05865c CBG05865c   [unknown]
CDS:CBG05865f CBG05865f   [unknown]
CDS:CBG05865a CBG05865a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_upregulated
  Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day6_vs_Day1_downregulated

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG05862, AAAGAAGTCGGGCGGAACGGTTGAGACACCGAATCAGTGAGAGAAGAACGAATGCCTATA, WBGene00028231   Expr1060129 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cbr-unc-82, TACACTCCAGGTCTAACTGATCAACGTCGTCATTGGTATGATGACCCGAATATTTATTAA, WBGene00028233   Expr1066387 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

3 GO Annotation

Annotation Extension Qualifier
  enables
  enables
  involved_in

0 Homologues

0 Locations

3 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region