WormBase Gene ID
|
WBGene00028166 | Gene Name | Cbr-hecd-1 |
| Sequence Name
|
CBG05779 | Organism | Caenorhabditis briggsae |
| Automated Description | Predicted to enable metal ion binding activity and ubiquitin-protein transferase activity. Predicted to be involved in protein ubiquitination. Is an ortholog of C. elegans hecd-1. In C. elegans, hecd-1 is involved in several processes, including hemidesmosome assembly; positive regulation of proteasomal ubiquitin-dependent protein catabolic process; and regulation of Notch signaling pathway. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG05779.1 | CBG05779.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-hecd-1, TGGAAAATCTTCTTGCACGAGCCATCCCTCACGCATTCGGAAGAATTGCTGAAAACCAAG, WBGene00028166 | Expr1050635 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
