WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00028073 Gene Name  CBG05669
Sequence Name  ? CBG05669 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable serine-type endopeptidase inhibitor activity. Is an ortholog of C. elegans Y43F8B.3. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

6 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG05669d.1 CBG05669d.1   [unknown]
Transcript:CBG05669c.1 CBG05669c.1   [unknown]
Transcript:CBG05669f.1 CBG05669f.1   [unknown]
Transcript:CBG05669e.1 CBG05669e.1   [unknown]
Transcript:CBG05669b.1 CBG05669b.1   [unknown]
Transcript:CBG05669a.1 CBG05669a.1   [unknown]
 

Other

6 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG05669e CBG05669e   [unknown]
CDS:CBG05669d CBG05669d   [unknown]
CDS:CBG05669f CBG05669f   [unknown]
CDS:CBG05669a CBG05669a   [unknown]
CDS:CBG05669c CBG05669c   [unknown]
CDS:CBG05669b CBG05669b   [unknown]

0 RNAi Result

2 Allele

Public Name
WBVar00005777
WBVar00005772

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

4 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_upregulated
  Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day6_vs_Day1_downregulated
  Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-spr-4(gu163)_upregulated
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day1_upregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG05669, TCAAAATGCAATCTTTTTTCAGAATCAATGCGTGCCATTCGAGTACACTGGCTGTGGAGG, WBGene00028073   Expr1053811 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region