WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00028044 Gene Name  Cbr-mlt-11
Sequence Name  ? CBG05636 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable serine-type endopeptidase inhibitor activity. Is an ortholog of C. elegans mlt-11. In C. elegans, mlt-11 is involved in cuticle development involved in collagen and cuticulin-based cuticle molting cycle. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

8 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG05636a.1 CBG05636a.1   [unknown]
Transcript:CBG05636c.1 CBG05636c.1   [unknown]
Transcript:CBG05636b.1 CBG05636b.1   [unknown]
Transcript:CBG05636e.1 CBG05636e.1   [unknown]
Transcript:CBG05636d.1 CBG05636d.1   [unknown]
Transcript:CBG05636g.1 CBG05636g.1   [unknown]
Transcript:CBG05636f.1 CBG05636f.1   [unknown]
Transcript:CBG05636h.1 CBG05636h.1   [unknown]
 

Other

8 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG05636e CBG05636e   [unknown]
CDS:CBG05636d CBG05636d   [unknown]
CDS:CBG05636g CBG05636g   [unknown]
CDS:CBG05636f CBG05636f   [unknown]
CDS:CBG05636h CBG05636h   [unknown]
CDS:CBG05636a CBG05636a   [unknown]
CDS:CBG05636c CBG05636c   [unknown]
CDS:CBG05636b CBG05636b   [unknown]

0 RNAi Result

2 Allele

Public Name
WBVar00005722
WBVar00005727

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_upregulated
  Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day1_upregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-mlt-11, GAGACACCAACCCGTACGAATCTCCAATACTTCTACTCGCCACGTGACAATCGATGCAAA, WBGene00028044   Expr1057695 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region