Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG05550.1 | CBG05550.1 | [unknown] |
Other
17 Allele
| Public Name |
|---|
| WBVar00040339 |
| WBVar00040344 |
| WBVar00110659 |
| WBVar00110660 |
| WBVar00110663 |
| WBVar00110664 |
| WBVar00110661 |
| WBVar00110662 |
| WBVar00110667 |
| WBVar00110668 |
| WBVar00110665 |
| WBVar00110666 |
| WBVar00012059 |
| WBVar00012064 |
| WBVar00012044 |
| WBVar00012049 |
| WBVar00012054 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Heat shock: 34C 30min. | Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min. | DESeq2 v 1.18.1, fold change > 2, FDR < 0.01. | WBPaper00058955:heatshock_upregulated_CBG |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG05550, GGGTCGTCGTGATGGAAATGTGTATCCGGCATTGATGGAATGGACCAAACATAGCAAATT, WBGene00027978 | Expr1058295 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
7 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| located_in |
