Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG05432.1 | CBG05432.1 | [unknown] |
Other
26 Allele
| Public Name |
|---|
| WBVar00044274 |
| WBVar00110586 |
| WBVar00110587 |
| WBVar00110584 |
| WBVar00110585 |
| WBVar00110588 |
| WBVar00110589 |
| WBVar00110590 |
| WBVar00110591 |
| WBVar00110575 |
| WBVar00110576 |
| WBVar00110573 |
| WBVar00110574 |
| WBVar00110579 |
| WBVar00110577 |
| WBVar00110578 |
| WBVar00110582 |
| WBVar00110583 |
| WBVar00110580 |
| WBVar00110581 |
| WBVar00110568 |
| WBVar00110569 |
| WBVar00110567 |
| WBVar00110571 |
| WBVar00110572 |
| WBVar00110570 |
4 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_upregulated | |
| Transcripts that showed significantly increased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_upregulated | |
| Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG05432, GATGCTCAACAAGAAATTCAAGACTCTGGAATGTTCGACACCACCGACGATTTCACATTT, WBGene00027883 | Expr1063926 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
