Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG05359.1 | CBG05359.1 | [unknown] |
Other
47 Allele
| Public Name |
|---|
| WBVar00136394 |
| WBVar00136393 |
| WBVar00136396 |
| WBVar00136395 |
| WBVar00136398 |
| WBVar00136397 |
| WBVar00110465 |
| WBVar00110466 |
| WBVar00110463 |
| WBVar00110464 |
| WBVar00110467 |
| WBVar00110432 |
| WBVar00110433 |
| WBVar00110430 |
| WBVar00110431 |
| WBVar00110436 |
| WBVar00110437 |
| WBVar00110434 |
| WBVar00110435 |
| WBVar00110438 |
| WBVar00110439 |
| WBVar00110440 |
| WBVar00110429 |
| WBVar00110428 |
| WBVar00110454 |
| WBVar00110455 |
| WBVar00110452 |
| WBVar00110453 |
| WBVar00110458 |
| WBVar00110459 |
4 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_upregulated | |
| Transcripts that showed significantly increased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_upregulated | |
| Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
2 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG05362, GAGCCATCGAGCAGCACAAATACGACATCCGCATGCGACAGGCGCAACAACACATGTACC, WBGene00027823 | Expr1059920 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
| Cbr-clec-78, CAAACTGCGAGGAAATCACCGACATTTGCTCCACGAATAATCCGTGTCGAAATGGTGCAA, WBGene00027820 | Expr1066493 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
