Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG05339.1 | CBG05339.1 | [unknown] |
Other
13 Allele
| Public Name |
|---|
| WBVar00110381 |
| WBVar00110384 |
| WBVar00110385 |
| WBVar00110382 |
| WBVar00110383 |
| WBVar00110388 |
| WBVar00110389 |
| WBVar00110386 |
| WBVar00110387 |
| WBVar00110391 |
| WBVar00110392 |
| WBVar00110390 |
| WBVar00110393 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_downregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG05338, CCGAAACAGAGGATCAACTACACTTTCAAGGGTGTACCACTACGTCTCCAGAAAAGGTCA, WBGene00027803 | Expr1067017 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
