Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG05065.1 | CBG05065.1 | [unknown] |
Other
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated | |
| C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo. | Benjamin and Hochberg corrected p-value < 0.05. | WBPaper00051425:CB_L4_vs_embryo_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-fah-1, CAAGAATGGCGTTAGAATTGGTTTCGGAGAATGCCGCGGAAGAATTCGCCCAGCCGATAT, WBGene00027613 | Expr1053851 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
