Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG04848.1 | CBG04848.1 | [unknown] |
Other
68 Allele
| Public Name |
|---|
| WBVar00037149 |
| WBVar00037154 |
| WBVar00037159 |
| WBVar00037169 |
| WBVar00037164 |
| WBVar00037179 |
| WBVar00037174 |
| WBVar00037109 |
| WBVar00037104 |
| WBVar00037114 |
| WBVar00037119 |
| WBVar00037124 |
| WBVar00037129 |
| WBVar00037134 |
| WBVar00037139 |
| WBVar00037144 |
| WBVar00037079 |
| WBVar00037074 |
| WBVar00037089 |
| WBVar00037084 |
| WBVar00037099 |
| WBVar00037094 |
| WBVar00037029 |
| WBVar00037034 |
| WBVar00037039 |
| WBVar00037044 |
| WBVar00037049 |
| WBVar00037059 |
| WBVar00037054 |
| WBVar00037069 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG04848, GATGTTGGGATTGGGAACCGGAAAAGCGTCCATCATTTGACGAATGTGAACAATATTTCA, WBGene00027448 | Expr1063735 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
