Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG04634a.1 | CBG04634a.1 | [unknown] | |
| Transcript:CBG04634b.1 | CBG04634b.1 | [unknown] |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:CBG04634b | CBG04634b | [unknown] | |
| CDS:CBG04634a | CBG04634a | [unknown] |
6 Allele
| Public Name |
|---|
| WBVar00109586 |
| WBVar00109587 |
| WBVar00109582 |
| WBVar00109583 |
| WBVar00109584 |
| WBVar00109585 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_upregulated | |
| Transcripts that showed significantly increased expression in day 6 adults of C.briggsae AF16 comparing to in day 3 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day3_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG04634, GTCTGGTGTATGATTGCATCTCAAGCTGGATTCAAGAACATTCAAGGAACAGTGAGCGCC, WBGene00027271 | Expr1054218 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
