WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00027087 Gene Name  Cbr-daf-14
Sequence Name  ? CBG04415 Organism  Caenorhabditis briggsae
Automated Description  Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans daf-14. In C. elegans, daf-14 is involved in several processes, including determination of adult lifespan; egg-laying behavior; and negative regulation of dauer larval development. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG04415c.1 CBG04415c.1   [unknown]
Transcript:CBG04415b.1 CBG04415b.1   [unknown]
Transcript:CBG04415b.2 CBG04415b.2   [unknown]
Transcript:CBG04415a.1 CBG04415a.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG04415b CBG04415b   [unknown]
CDS:CBG04415c CBG04415c   [unknown]
CDS:CBG04415a CBG04415a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG26463, AGGGATTGGTCAAGTCAGCGGTGCAAGAGGAGGACAAGGAAGTAGAGAGCAAGCTGCAGG, WBGene00087877   Expr1058350 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cbr-daf-14, ACATGATGAACTTGGAAATCTTCTTCATGAGGATAAGTTGCCAACCATCAAGCTCTTCGA, WBGene00027087   Expr1055702 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  involved_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region