Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG02837.1 | CBG02837.1 | [unknown] |
Other
12 Allele
| Public Name |
|---|
| WBVar00107767 |
| WBVar00107766 |
| WBVar00107765 |
| WBVar00107764 |
| WBVar00107763 |
| WBVar00107762 |
| WBVar00107761 |
| WBVar00107760 |
| WBVar00107759 |
| WBVar00107758 |
| WBVar00107757 |
| WBVar00107768 |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-nep-1, GTAAACACCGTGCTTTCAAACCAGCCAGAATTTGCCGAAGCCTTCAAATGCCCAGCCGGC, WBGene00025811 | Expr1057948 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
