Genomics
3 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG02659b.1 | CBG02659b.1 | [unknown] | |
| Transcript:CBG02659a.1 | CBG02659a.1 | [unknown] | |
| Transcript:CBG02659c.1 | CBG02659c.1 | [unknown] |
Other
3 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:CBG02659b | CBG02659b | [unknown] | |
| CDS:CBG02659c | CBG02659c | [unknown] | |
| CDS:CBG02659a | CBG02659a | [unknown] |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
2 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-dgk-5, CACAACATTACTTACTACGCAGGAGGAACGATTCCATGGGGTGAATCTTCTGAATCCAAA, WBGene00025673 | Expr1054147 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
| CBG02658, CGCATCATCCTTCTATGAATGCACAAATGCTTTTCGAAACTTGCCATTTTCTTCCACTTC, WBGene00025672 | Expr1050215 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
