WormBase Gene ID
|
WBGene00025376 | Gene Name | Cbr-nsy-1 |
| Sequence Name
|
CBG02299 | Organism | Caenorhabditis briggsae |
| Automated Description | Predicted to enable ATP binding activity and protein kinase activity. Predicted to be involved in MAPK cascade and protein phosphorylation. Is an ortholog of C. elegans nsy-1. In C. elegans, nsy-1 is involved in several processes, including determination of adult lifespan; positive regulation of macromolecule biosynthetic process; and response to stress. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG02299.1 | CBG02299.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-nsy-1, GACTATCATTCAAGCAGTGCTGATGATATGTTCACAACCGTTTCAGCTGCTGATGCCACA, WBGene00025376 | Expr1055976 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
