Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG02097.1 | CBG02097.1 | [unknown] |
Other
17 Allele
| Public Name |
|---|
| WBVar00106996 |
| WBVar00106997 |
| WBVar00106998 |
| WBVar00106999 |
| WBVar00107000 |
| WBVar00107001 |
| WBVar00054469 |
| WBVar00054464 |
| WBVar00054459 |
| WBVar00022874 |
| WBVar00022879 |
| WBVar00022884 |
| WBVar00022889 |
| WBVar00022859 |
| WBVar00022894 |
| WBVar00022864 |
| WBVar00022869 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG02097, GCAATGAGAGAACGACTAACGGCTAGCAGTTTGAACTCTGACGAATCGGATGACAACGAG, WBGene00025221 | Expr1068160 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
