Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG01831.1 | CBG01831.1 | [unknown] |
Other
9 Allele
| Public Name |
|---|
| WBVar00044189 |
| WBVar00069691 |
| WBVar00069676 |
| WBVar00069681 |
| WBVar00069696 |
| WBVar00069666 |
| WBVar00015174 |
| WBVar00069671 |
| WBVar00069686 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG01831, CTAATTGGAATGATTTTCGGAGAGATGAGCTTGGTGCTTTTGTATGTTATGATCTTCTTC, WBGene00025016 | Expr1050653 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
