WormBase Gene ID
|
WBGene00024896 | Gene Name | Cbr-sar-1 |
| Sequence Name
|
CBG01701 | Organism | Caenorhabditis briggsae |
| Automated Description | Predicted to enable GTP binding activity and GTPase activity. Predicted to be involved in intracellular protein transport. Is an ortholog of C. elegans sar-1. In C. elegans, sar-1 is involved in embryo development. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG01701.1 | CBG01701.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG01701, TCGATAAACCAGGAGCTTTGAGTGAGGACCAGCTGAAGTGGCAGCTCAACATTCAACACA, WBGene00024896 | Expr1062528 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
