Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG01571.1 | CBG01571.1 | [unknown] |
Other
26 Allele
| Public Name |
|---|
| WBVar00141590 |
| WBVar00141591 |
| WBVar00141592 |
| WBVar00043824 |
| WBVar00043829 |
| WBVar00043834 |
| WBVar00043839 |
| WBVar00043844 |
| WBVar00043809 |
| WBVar00043804 |
| WBVar00043819 |
| WBVar00043814 |
| WBVar00068741 |
| WBVar00014789 |
| WBVar00014794 |
| WBVar00068746 |
| WBVar00068751 |
| WBVar00014799 |
| WBVar00014804 |
| WBVar00068756 |
| WBVar00068761 |
| WBVar00014809 |
| WBVar00014814 |
| WBVar00068766 |
| WBVar00068771 |
| WBVar00014819 |
4 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 3 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day3_vs_Day1_downregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated | |
| Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-try-2, GTGCACAGAAGAAACAACCGGGTATTTATACTATGGTGGCTCCATATCTCTCATGGATTA, WBGene00024790 | Expr1060094 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
