Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG01531.1 | CBG01531.1 | [unknown] |
Other
22 Allele
| Public Name |
|---|
| WBVar00068621 |
| WBVar00068636 |
| WBVar00068606 |
| WBVar00068641 |
| WBVar00068611 |
| WBVar00068626 |
| WBVar00068631 |
| WBVar00068616 |
| WBVar00057604 |
| WBVar00057599 |
| WBVar00057589 |
| WBVar00057594 |
| WBVar00057584 |
| WBVar00068581 |
| WBVar00026149 |
| WBVar00026154 |
| WBVar00068586 |
| WBVar00068591 |
| WBVar00026159 |
| WBVar00026164 |
| WBVar00068596 |
| WBVar00068601 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-glr-5, TTTGGAATACAGTATGGTACGTGTTGAGTACAATGTTAAAAGGTGGATGTGACTTTGGAC, WBGene00024756 | Expr1056510 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
