Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG01094.1 | CBG01094.1 | [unknown] |
Other
24 Allele
| Public Name |
|---|
| WBVar00048684 |
| WBVar00048679 |
| WBVar00048694 |
| WBVar00048689 |
| WBVar00048674 |
| WBVar00048669 |
| WBVar00066651 |
| WBVar00066621 |
| WBVar00066591 |
| WBVar00066656 |
| WBVar00066626 |
| WBVar00066661 |
| WBVar00066596 |
| WBVar00066631 |
| WBVar00066601 |
| WBVar00066666 |
| WBVar00066636 |
| WBVar00066671 |
| WBVar00066606 |
| WBVar00066641 |
| WBVar00066611 |
| WBVar00066676 |
| WBVar00066646 |
| WBVar00066616 |
4 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated | |
| Heat shock: 34C 30min. | Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min. | DESeq2 v 1.18.1, fold change > 2, FDR < 0.01. | WBPaper00058955:heatshock_upregulated_CBG |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-ptr-16, CCGGTGACCTGTCTCGATTATTTGGAGGATCGAGTGATTCCAAAATACAACCTGAAAAAA, WBGene00024376 | Expr1069633 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
