Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG00906.1 | CBG00906.1 | [unknown] |
Other
14 Allele
| Public Name |
|---|
| WBVar00065178 |
| WBVar00065213 |
| WBVar00065183 |
| WBVar00065218 |
| WBVar00065188 |
| WBVar00065158 |
| WBVar00065223 |
| WBVar00065193 |
| WBVar00065163 |
| WBVar00065198 |
| WBVar00065168 |
| WBVar00065203 |
| WBVar00065173 |
| WBVar00065208 |
1 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG00906, TCGACAACACGATATGCGAACTGCTGCACGAGGTGAAATCAATGATTCACGGAACAGAAC, WBGene00024221 | Expr1062611 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
