Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG00882.1 | CBG00882.1 | [unknown] |
Other
11 Allele
| Public Name |
|---|
| WBVar00065018 |
| WBVar00065053 |
| WBVar00065038 |
| WBVar00065023 |
| WBVar00065008 |
| WBVar00065058 |
| WBVar00065043 |
| WBVar00065028 |
| WBVar00065013 |
| WBVar00065048 |
| WBVar00065033 |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated | |
| C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo. | Benjamin and Hochberg corrected p-value < 0.05. | WBPaper00051425:CB_L4_vs_embryo_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cbr-tag-165, CGGAAAACGCGAAAATTTTCATTTGTGGCGACGCGAAGGGCATGTCGAAAGACGTTTGGC, WBGene00024201 | Expr1058116 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
