Genomics
7 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG00686g.1 | CBG00686g.1 | [unknown] | |
| Transcript:CBG00686f.1 | CBG00686f.1 | [unknown] | |
| Transcript:CBG00686e.1 | CBG00686e.1 | [unknown] | |
| Transcript:CBG00686d.1 | CBG00686d.1 | [unknown] | |
| Transcript:CBG00686c.1 | CBG00686c.1 | [unknown] | |
| Transcript:CBG00686b.1 | CBG00686b.1 | [unknown] | |
| Transcript:CBG00686a.1 | CBG00686a.1 | [unknown] |
Other
7 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:CBG00686b | CBG00686b | [unknown] | |
| CDS:CBG00686c | CBG00686c | [unknown] | |
| CDS:CBG00686a | CBG00686a | [unknown] | |
| CDS:CBG00686f | CBG00686f | [unknown] | |
| CDS:CBG00686g | CBG00686g | [unknown] | |
| CDS:CBG00686d | CBG00686d | [unknown] | |
| CDS:CBG00686e | CBG00686e | [unknown] |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG00686, GGGTATTGTAATATTTGCTGCACTGGTCTATTATGCGGAACGAGTCGAACGCAATGAGAA, WBGene00024041 | Expr1057460 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
8 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| located_in | |
| part_of |
