Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG00476.1 | CBG00476.1 | [unknown] |
Other
12 Allele
| Public Name |
|---|
| WBVar00141267 |
| WBVar00141268 |
| WBVar00141269 |
| WBVar00141264 |
| WBVar00141265 |
| WBVar00141266 |
| WBVar00141270 |
| WBVar00141271 |
| WBVar00141272 |
| WBVar00141273 |
| WBVar00141274 |
| WBVar00141275 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG00476, ACACTTTCGAATACTCATCTGTTCTCTCCATCGTATATTATAGTAGCTGGGACCAAGAAA, WBGene00023856 | Expr1062647 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
