Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG00466.1 | CBG00466.1 | [unknown] |
Other
9 Allele
| Public Name |
|---|
| WBVar00030154 |
| WBVar00030159 |
| WBVar00003084 |
| WBVar00003089 |
| WBVar00003074 |
| WBVar00003079 |
| WBVar00062668 |
| WBVar00062658 |
| WBVar00062663 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo. | Benjamin and Hochberg corrected p-value < 0.05. | WBPaper00051425:CB_L4_vs_embryo_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG00466, TGCATGATCCAATGGCAATGCGACCATTCATGGGATACAACTATGGAAAGTACTTGGAGC, WBGene00023849 | Expr1062549 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
